Haplogroup I-M170

Haplogroup I (M170) is a Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ, which itself is a derivative of the haplogroup IJK. Subclades I1 and I2 can be found in most present-day European populations, with peaks in some Northern European and Southeastern European countries.

Haplogroup I-M170
Possible time of origin~42,900 Years BP
Coalescence age~27,500 Years BP
Possible place of originEurope
AncestorIJ
DescendantsI*, I1, I2
Defining mutationsL41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179

Haplogroup I appears to have arisen in Europe, so far being found in Palaeolithic sites throughout Europe (Fu 2016), but not outside it. It diverged from common ancestor IJ* about 43,000 years B.P. (Karafet 2008). Early evidence for haplogroup J has been found in the Caucasus and Iran (Jones 2015, Fu 2016). In addition, living examples of the precursor Haplogroup IJ* have been found only in Iran, among the Mazandarani and ethnic Persians from Fars.[1] This may indicate that IJ originated in South West Asia.

Haplogroup I has been found in multiple individuals belonging to the Gravettian culture. The Gravettians expanded westwards from the far corner of Eastern Europe, likely Russia, to Central Europe. They are associated with a genetic cluster that is normally called the Věstonice cluster.[2][3][4]

Origins

Spread of Cro-Magnons
European LGM refuges, 20,000 years BP.
  Solutrean and Proto-Solutrean Cultures
  Epi-Gravettian Culture

Available evidence suggests that I-M170 was preceded into areas in which it would later become dominant by haplogroups K2a (K-M2308) and C1 (Haplogroup C-F3393). K2a and C1 have been found in the oldest sequenced male remains from Western Eurasia (dating from circa 45,000 to 35,000 years BP), such as: Ust'-Ishim man (modern west Siberia) K2a*, Oase 1 (Romania) K2a*, Kostenki 14 (south west Russia) C1b, and Goyet Q116-1 (Belgium) C1a.[5][6] The oldest I-M170 found is that of an individual known as Krems WA3 (lower Austria), dating from circa 33,000-24,000 BP. At the same site, two twin boys were also found, both were assigned to haplogroup I*.[7][8]

Haplogroup IJ was in the Middle East and/or Europe about 40,000 years ago. The TMRCA (time to most recent common ancestor) for I-M170 was estimated by Karafet and colleagues in 2008 to be 22,200 years ago, with a confidence interval between 15,300 and 30,000 years ago.[9] This would make the founding event of I-M170 approximately contemporaneous with the Last Glacial Maximum (LGM), which lasted from 26,500 years ago until approximately 19,500 years ago.[10] TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24,000 ±7,100 years ago and time to population divergence as 23,000 ±7,700 years ago.[11] These estimates are consistent with those of Karafet 2008 cited above. However, Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28,400 ±5,100 years ago, although they calculate the STR variation age of I1 at only 8,100 ±1,500 years ago.[12]

Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.[13] Later the haplogroup, along with two cases of Haplogroup C, was found in human remains belonging to the previously mentioned Gravettian culture and in individuals of the Magdalenian and Azilian cultures.[14] Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I-M170 experienced an independent population expansion immediately after the Last Glacial Maximum.[11]

The five known cases of Haplogroup I from Upper Paleolithic European human remains make it one of the most frequent haplogroup from that period.[14] In 2016, the 31,210–34,580-year-old remains of a hunter-gatherer from Paglicci Cave, Apulia, Italy were found to carry I-M170.[15] So far, only Haplogroup F* and Haplogroup C1b have been documented, once each, on older remains in Europe. I2 subclade of I-M170 is the main haplogroup found on male remains in Mesolithic Europe, until circa 6,000 BCE, when mass migration into Europe of Anatolian farmers carrying Y-DNA G2a happened.[16]

Due to the arrival of so-called Early European Farmers (EEFs), I-M170 is outnumbered by Haplogroup G among Neolithic European remains and by Haplogroup R in later remains.

The earliest documentation of I1 is from Neolithic Hungary, although it must have separated from I2 at an earlier point in time.

In one instance, haplogroup I was found far from Europe, among 2,000-year-old remains from Mongolia.[17]

It would seem to be that separate waves of population movement impacted Southeastern Europe. The role of the Balkans as a long-standing corridor to Europe from Anatolia and/or the Caucasus is shown by the common phylogenetic origins of both haplogroups I and J in the parent haplogroup IJ (M429). This common ancestry suggests that the subclades of IJ entered the Balkans from Anatolia or the Caucasus, some time before the Last Glacial Maximum. I and J were subsequently distributed in Asia and Europe in a disjunctive phylogeographic pattern typical of "sibling" haplogroups. A natural geographical corridor like the Balkans is likely to have been used later by members of other subclades of IJ, as well as other haplogroups, including those associated with Early European Farmers.

The existence of Haplogroup IJK – the ancestor of both haplogroups IJ and K (M9) – and its evolutionary distance from other subclades of Haplogroup F (M89), supports the inference that haplogroups IJ and K both arose in Southwestern Asia. Living carriers of F* and IJ* have been reported from the Iranian Plateau.[1]

Distribution

Frequencies of Haplogroup I:

Population % hg I % hg I (Subpopulation) Sampled individuals Source
Abazinians3.4 88 Sergeevich 2007[18]
Abkhazians33.3 12 Nasidze Ivan 2004[19]
Adyghe (Adygea)7 154 [20]
Adyghe (Cherkessia)2 126 Sergeevich 2007[18]
Adyghe (Kabardia)10 59 Nasidze Ivan 2004[19]
Afghanistan 3 (Hazara people) 60 El Sibai 2009[21]
Afghanistan1.5% 3.3% (2/60) Hazara, 1.8% (1/56) Tajik 204 Haber et al. 2012[22]
Afghanistan0.99% 2.6% (2/77) Hazara, 2.1% (3/142) Tajiks, 0/74 Turkmens, 0/87 Pashtuns, 0/127 Uzbeks 507 Di Cristofaro 2013[23]
Albanians 13% (29/223) (Albania) 223 Sarno 2015
Albanians 16 (Tosk), 4 (Gheg) Ferri 2010
Albanians 21.82% (12/55) (Tirana) 55 Battaglia 2008
Albanians 7 (Tirana) 30 Bosch 2006
Algerians0 156 [24]
Andis27
Armenians5 FTDNA 2013[25]
Avars2 115 Balanovsky
Austrians28 50 (Vienna), 29 (Graz), 6 (Tyrol) [26]
Ashkenazi1 1099 [27]
Azeri3 72 Nasidze Ivan 2004
Balkars3 135 Kutuev 2007[28]
Belarusians2311 (West), 15 (North), 16 (East), 28 (Centre), 30 (East Polesie), 34 (West Polesie) 565 Kushniarevich 2013
Belarusians32Polesie- 43 (Vichin), 12 (Avtyuki) 204 Sergeevich 2015[29]
Bosnia and Herzegovina5373 (Croats), 49 (Bosniaks), 33 (Serbs) 256 Marjanovic 2006
Bosnia and Herzegovina65 Herzegovina- 71 (Mostar, Siroki Brijeg), Bosnia- 54 (Zenica) 210 Pericic 2005[30]
Bosnia and Herzegovina 73 (Croats), 45 (Bosniaks), 36 (Serbs) 255 Battaglia 2008[31]
Bulgarians27-2940 (Varna), 32 (Sofia), 30 (Plovdiv), 10 (Haskovo) 935Karachanak 2009–13[32][33]
Bulgarians34 100 Begona Martinez-Cruz 2012
Bulgaria 19 (Bulgarian Turks) 63 Zaharova 2002[34]
Central Asia2 984 Rootsi 2004
Chechens0 330 Balanovsky
Croats46 1100 Mrsic 2012
Croats4428 (Osijek) 89 Battaglia 2008[31]
Croats66 (Hvar),54 (Korcula), 55 (Brac), 28 (Krk) Barac 2003[35]
Cyprus1 164 El-Sibai 2009[36]
Czechs18 25 (Klatovy), 25 (Písek), 15 (Brno) 14 (Hradec Králové), 10 (Třebíč) 257 Luca 2007[37]
Danes39 194 Rootsi 2004
Darginians58 26 Nasidze Ivan 2004
Darginians (Kaitak)0 101
Dutch27.8 2085 Altena 2020[38]
Dutch33 410 Van Doorn 2008[39]
Egyptians0 124 El-Sibai 2009[40]
Egyptians1 370 [24]
Estonians19 194 Rootsi 2004
English18 945 Rootsi 2004
English26 12 (Cornwall), 38 (Essex) 1830 FTDNA 2016[41]
Estonians17 118 Lappalainen 2008[42]
Flemish Belgians28 113 [43]
Finland29 52 (Satakunta), 47 (Ostrobothnia), 36 (Swedes from Ostrobothnia), 15 (Northern Savo) 536 Lappalainen 2006[44]
French 16 (South), 24 (Normandy), 4 (Lyon), 4 (Corsica) Rootsi 2004
French9 5 (Auvergne), 13 (Brittany), 9 (Nord Pas de Calais) 555 Ramos-Luis 2009[45]
French13 11 (Paris), 18 (Strasburg), 10 (Lyon) 333 Kari Hauhio[26]
Gagauzes28 89 Varzari 2006
Georgians0 63 Rootsi 2004
Georgians4 77 Nasidze Ivan 2004
Germans24 32 (Berlin), 32 (Hamburg), 15 (Leipzig) 1215 Kayser 2005[46]
Greeks14 30 (Macedonia) 261 Rootsi 2004
Greeks10 (Athens), 30 (Macedonia) 149 Battaglia 2008
Greeks36 (Serres), 24 (Agrinio), 20 (Thessaloniki), 18 (Mytilene), 14 (Crete), 14 (Larissa), 11 (Patrai), 12 (Karditsa), 8 (Ioannina), 2 (Chios) 366 Di Giacommo 2003[47]
Greeks12 (North), 24 (South) 142 Zalloua 2008
Greenlanders17 215 Sanchez 2004[48]
Hungarians23 162 Rootsi 2004
Hungarians28 230 Vago Zalan Andrea 2008
Indians 0 (North India) 560 [49]
Ingush0 143
Iranians2 22 (South Iran), 5 (Khorasan), 0 (Teheran) 186 Di Cristofaro 2013[23]
Iranians 1 (West), 1 (East) 324 [50]
Iranians0 83 Rootsi 2004
Iranians1 92 El-Sibai 2009[36]
Iranians0 6 (Armenians of Teheran), 0 (Persians of Teheran, Fars, Isfahan, Khorasan, Yazd) 952 Grugni 2012
Iraqis1 176 Rootsi 2004[51]
Iraqis1 117 El-Sibai 2009[36]
Irish11 76 Rootsi 2004
Irish10 119 Cappeli 2013[52]
Irish 11 (Rush, Dublin) Capelli 2003
Italians 5 (North), 7 (Central), 9 (South and Sicily), 39 (Sardinia) Rootsi 2004
Italians10 31 (Sardinia), 4 (Umbria, Marche) 884 Boattini 2013[53]
Italians7 0 (Calabria, Pescara, Garfagnana, Val di Non), 5 (Verona), 7(Genoa), 19 (Foggia) 524 Di Giacomo 2003[54]
Italians 36 (Filettino) 35 (Cappadocia, Abruzzo), 28 (Vallepietra) Messina 2015[55]
Italians 23 (Udine), 17 (Saniti), 13 (Picenium), 7 (Latini) 583 Brisighelli 2012[56]
Italians 30 (Stelvio) [57]
Italians 31 (Caccamo) Gaetano 2008[58]
Jordanians1 273 El-Sibai 2009[36]
Jordanians 5 (Amman), 0 (Dead Sea) 146 Flores 2005[59]
Kara Nogays13 76
Karachays9 69 Sergeevich 2007[18]
Kazakhs1 370 [60]
Kosovar Albanians8 114 Pericic 2005
Kumyks0 73 Kutuev 2007[28]
Kurds 4 (West Iran) 21 Malyarchuk 2013[61]
Kurds 2 (Iran) 59 Gragni 2012
Kurmanji 17 (Turkey), 0 (Georgia) 112 Nasidze 2005[62]
Kuwaiti0 42 El-Sibai 2009[36]
Kyrgyzstan 0 (Uyghurs), 0 (Kyrgyz) Di Cristofaro 2013[23]
Laks14 [63]
Latvians9 3 (Southwest) [64]
Lebanese3 10 (North Maronite), 0 (Shia) 951 [36][65]
Lebanese5 66 Rootsi 2004
Lezgis0 81
Lithuanians7 Kushniarevich 2015
Libyans0 83 [24]
Libyans2 1 175 Fendri 2015[66]
Macedonians34 (Skopje) 79 Pericic 2005
Macedonians2431 (Macedonians), 12 (Albanians) 343 Noevski 2010
Macedonians13 (Albanians) 64 Battaglia 2008[31]
Maltese12 90 El-Sibai 2009[36]
Moldovans29 (Moldovans), 25 (Ukrainians) Varzari 2006
Moroccans0 316 El-Sibai 2009[36]
Moroccans0 760 [24]
Mongols1 160 Di Cristofaro 2013[23]
Norwegians45 906 FTDNA[67]
Norwegians37 40 (Oslo) 30 (West), 42 (East, South), 35 (North), 33 (Bergen) Dupuy 2005
Pakistan0 638 [68]
Poles1719 (Warsaw), 12 (Lublin), 22 (Szczecin) 913 Kayser 2005
Poles18 191 Rootsi 2004
Portuguese5 303 Rootsi 2004
Portuguese8 3 (Lisboa), 0 (Setubal), 18 (Braga) 657 Beleza 2005[69]
Qatar0 72 El-Sibai 2009[36]
Romani 17 (Hungary), 10 (Tiszavasvari), 5 (Tokaj) 37 (Taktakoz), 11 (Slovakia) Vago Zalan Andrea 2008
Romanians28 36 (Brasov), 18 (Cluj) 178 Martinez-Cruz 2012[70]
Romanians22 361 Rootsi 2004
Russians 13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (Unzha), 0 (Mezen) 1228 Balanovsky 2008
Russia 2 (Udmurts), 5 (Pinega), 5 (Komi), 5 (Tatars), 6 (Bashkortostan), 7 (Chuvashes), 19 (Kostroma), 11 (Smolensk), 17 (Belgorod), 19 (Mordvins), 23 (Cossacks), 24 (Adygea) Rootsi 2004
Saami31 Rootsi 2004
Saudis0 1597 [71]
Scotland11 17 (Scottish Isles) Rootsi 2004
Sephardi4 (Portugal) 57
Slovaks28 250 Petrejcikova 2013[72]
Slovenians30 57 (Spodnjeposavska) 458 Vakar 2010[73]
Spaniards6 18 (Asturias), 0 (Gascony) 1002 Adams 2008[74]
Sudanese 5 (Nubians), 4 (Gaalien), 7 (Mesereia) [75]
Swedes4232 (Ostergotaland & Jonkoping) 50 (Gotland & Varmland) 305 Karlsson2006[76]
Swedes26 (North Sweden),[77] Rootsi2004
Swedes 41 (South), 26 (North) Rootsi 2004
Swedes44 60 (Kristianstad), 60 (Kalmar), 59 (Kronoberg), 55 (Stockholm), 37 (North Norrland), 52 (South Norrland) 1800 FTDNA 2016[78]
Swiss8 144 Rootsi 2004
Swiss23 13 (Lausanne), 32 (Bern) [26]
Syrians 2 (West), 3 (East) 520 [50]
Syrians2 554 El Sibai 2009[36]
Tataers 33 (China) 33 [79]
Tunisians0 El-Sibai 2009[36]
Tunisians0 601 [24]
Turks5 12 (Marmara), 10 (Istanbul), 7 (Western Anatolia), 4 (Central Anatolia), 0 (Eastern Anatolia ) 523 Cinnioglu 2003
Turks5 741 Rootsi 2004
UAE0 164 El-Sibai 2009[36]
Ukrainians22 585 Rootsi 2004
Ukrainians28 33 (Sumy), 23 (Ivano-Frankivsk) 701 Kushniarevich 2013
Welsh8 196 Rootsi 2004
Yemenese0 62 El-Sibai 2009[36]
Zazas 33 (Turkey) 27 Nasidze 2005[62]
17 (Albanians in Tirana), 29 (Macedonians in Skopje), 21 (Aromanians in Krusevo), 19 (Greeks in Thrace), 42 (Aromanians in Andon Poci), 42 (Romanians in Constanta), 39 (Romanians in Piteşti) Bosch 2006[80]
47 (Romanians from Buhusi and Piatra Neamț), 35 (Moldovans from Sofia), 24 (Moldovans from Karasahani) 24 (Gagauzes from Etulia), 31 (Gagauzes from Kongaz), 25 (Ukrainians from Rashkovo) Vazari 2006
38 (Sweden), 41 (Western Finland), 28 (Eastern Finland), 18 (Karelia), 12 (Lithuania), 7 (Latvia), 17 (Estonia) Lappalainen2008[81]
34 (Iranians from Teheran), 10 (Iranians from Isfahan), 32 (Ossetians from Ardon), 13 (Ossetians from Digora) Nasidze Ivan. 2004[19]
3 (Tajiks) 3 (East Persians) Malyarchuk 2013[61]
2 (Kizhi), 4 (Teleuts), 4 (Khakassians), 3 (Todjins), 2 (Evenks) 3 (Tofalars), 1 (Tuvinians)

Subgroups

The subclades of Haplogroup I-M170 with their defining mutations, as of 2011.[82] Up-to-date phylogenetic trees listing all currently known subclades of I can be found at Y-Full and FamilyTreeDNA

  • I-M170 ( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179) Middle East, Caucasus, Europe.
    • I-M253 Haplogroup I1 (L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253, M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe In Anatolia at 1%[83]
      • I1a DF29/S438
        • I1a1 CTS6364/Z2336
          • I1a1a M227
            • I1a1a1 M72
          • I1a1b L22/S142
            • I1a1b1 P109
            • I1a1b2 L205
            • I1a1b3 L287
              • I1a1b3a L258/S335
                • I1a1b3a1 L296
            • I1a1b4 L300/S241
            • I1a1b5 L813/Z719
        • I1a2 S244/Z58
          • I1a2a S246/Z59
            • I1a2a1 S337/Z60, S439/Z61, Z62
              • I1a2a1a Z140, Z141
                • I1a2a1a1 Z2535
                  • I1a2a1a1a L338
                • I1a2a1a2 F2642
              • I1a2a1b Z73
              • I1a2a1c L573
              • I1a2a1d L1248
                • I1a2a1d1 L803
            • I1a2a2 Z382
          • I1a2b S296/Z138, Z139
            • I1a2b1 Z2541
        • I1a3 S243/Z63
          • I1a3a L1237
      • I1b Z131[84]
    • I-M438 Haplogroup I2 L68/PF3781/S329, M438/P215/PF3853/S31
      • I2a L460/PF3647/S238
        • I2a1 P37.2
          • I2a1a L158/PF4073/S433, L159.1/S169.1, M26/PF4056
            • I2a1a1 L160/PF4013
          • I2a1b L178/S328, M423
            • I2a1b1 L161.1/S185
            • I2a1b2 L621/S392
              • I2a1b2a1a L147.2
          • I2a1c L233/S183
        • I2a2 L35/PF3862/S150, L37/PF6900/S153, L181, M436/P214/PF3856/S33, P216/PF3855/S30, P217/PF3854/S23, P218/S32
          • I2a2a L34/PF3857/S151, L36/S152, L59, L368, L622, M223, P219/PF3859/S24, P220/S119, P221/PF3858/S120, P222/PF3861/U250/S118, P223/PF3860/S117, Z77
            • I2a2a1 CTS616, CTS9183
              • I2a2a1a M284
                • I2a2a1a1 L1195
                  • I2a2a1a1a L126/S165, L137/S166, L369
                  • I2a2a1a1b L1193
              • I2a2a1b L701, L702
                • I2a2a1b1 P78
                • I2a2a1b2 L699, L703
                  • I2a2a1b2a L704
              • I2a2a1c Z161
                • I2a2a1c1 L801/S390
                  • I2a2a1c1a CTS1977
                    • I2a2a1c1a1 P95
                  • I2a2a1c1b CTS6433
                    • I2a2a1c1b1 Z78
                      • I2a2a1c1b1a L1198
                        • I2a2a1c1b1a1 Z190
                          • I2a2a1c1b1a1a S434/Z79
                • I2a2a1c2 L623, L147.4
              • I2a2a1d L1229
                • I2a2a1d1 Z2054
                  • I2a2a1d1a L812/S391
                • I2a2a1d2 L1230
            • I2a2a2 L1228
          • I2a2b L38/S154, L39/S155, L40/S156, L65.1/S159.1, L272.3
            • I2a2b1 L533
      • I2b L415, L416, L417
      • I2c L596/PF6907/S292, L597/S333

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer.

I-M170

The composite subclade I-M170 contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several I* individuals, who do not fall into any known subclades, have been found among the Lak people of Dagestan, at a rate of (3/21),[85] as well as Turkey (8/741), Adygea in the Caucasus (2/138) and Iraq (1/176), even though I-M170 occurs at only very low frequencies among modern populations of these regions as a whole. This is consistent with the belief that the haplogroup first appeared in South West Eurasia.

There are also high frequencies of Haplogroup I* among the Andalusians (3/103), French (4/179), Slovenians (2/55), Tabassarans (1/30),[85] and Saami (1/35).[86]

(Neither study from which the above figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so these presumed cases I* may possibly belong to I2.)

A living Hazara male from Afghanistan has also been found to carry I*, with all known subclades of both I1 (M253) and I2 (M438) ruled out.[87]

I1-M253

Haplogroup I1-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%. I1 is believed to have become common as a result of a founder effect during the Nordic Bronze Age, and subsequently spread throughout Europe during the Migration Period when Germanic tribes migrated from southern Scandinavia and northern Germany to other places in Europe.[88]

Outside Fennoscandia, distribution of Haplogroup I1-M253 is closely correlated with that of Haplogroup I2a2-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I-M170 Y-chromosomes are I1-M253. Another characteristic of the Scandinavian I1-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1-M253 among the modern French and Italian populations. This, along with the structure of the phylogenetic tree of I1-M253 strongly suggests that most living I1 males are the descendants of an initially small group of reproductively successful men who lived in Scandinavia during the Nordic Bronze Age.[89][90]

I2-M438

Haplogroup I2-M438, previously I1b, may have originated in southern Europe – it is now found at its highest frequencies in the western Balkans and Sardinia – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596.

I2a1a-M26


Haplogroup I2a1a-M26 is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the Sardinians, and I2a1a-M26 is the predominant type of I among them.

Haplogroup I2a1a-M26 is practically absent east of France and Italy,[91] while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile-León, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I2a1a-M26 appears to be the only subclade of Haplogroup I-M170 found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile-León in Spain and Béarn in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[91]

The distribution of I2a1a-M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.[91]

I2a1b-M423

The approximate frequency and variance distribution of haplogroup I-P37 clusters, ancestral "Dnieper-Carpathian" (DYS448=20) and derived "Balkan" (DYS448=19: represented by a single SNP I-PH908), in Eastern Europe per O.M. Utevska (2017).

Haplogroup I2a1b-M423 is the most frequent Y-chromosome haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50–60%[30]) and Bosnia-Herzegovina (up to 71%,[92] avg. 40-50%[30]). Its subclade I-L161 has greater variance in Ireland and Great Britain, but overall frequency is very low (2–3%), while subclade I-L162 has the highest variance and also high concentration in Eastern Europe (Ukraine, Southeastern Poland, Belarus).[93]

I2a2-M436

The distribution of Haplogroup I2a2-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey may be related to the Varangian Guard or rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.[94]

Haplogroup I2a2-M436 also occurs among approximately 1% of Sardinians, and in Hazaras from Afghanistan at 3%.[95]

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

Height

This haplogroup reaches its maximum frequency in the Western Balkans (with the highest concentration of I2 in present-day Herzegovina). It may be associated with unusually tall males, since those in the Dinaric Alps have been reported to be the tallest in the world, with an average male height of the range 180 cm (5 ft 11 in)–182 cm (6 ft 0 in) in the cantons of Bosnia, 184 cm (6 ft 0 in) in Sarajevo, 182 cm (6 ft 0 in)–186 cm (6 ft 1 in) in the cantons of Herzegovina mostly populated by Croats.[96] A 2014 study examining the correlation between Y-DNA haplogroups and height found a correlation between the haplogroups I1, R1b-U106, I2a1b-M423 and tall males.[97] The study featured the measured average heights of young German, Swedish, Dutch, Danish, Serbian and Bosnian men. The German male average height was 180.2 cm, the Swedish men were on average 181.4 cm, the Dutch men were 183.8 cm, the Danish men were 180.6 cm, the Serbians were 180.9 cm, and Bosnian Croat men from Herzegovina were 185.2 centimeters on average.

See also

Notes

  • Barać L, Pericić M, Klarić IM, et al. (July 2003). "Y chromosomal heritage of Croatian population and its island isolates" (PDF). Eur. J. Hum. Genet. 11 (7): 535–42. doi:10.1038/sj.ejhg.5200992. PMID 12825075. S2CID 15822710.
  • Bennett, E.A., Prat, S., Péan, S., Crépin, L., Yanevich, A., Puaud, S., ... & Geigl, E. M. (2019). The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European. BioRxiv, 685404.
  • Rootsi, S, Kivisild, T, Benuzzi, G, Help, H, et al. (2019). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe". Am. J. Hum. Genet. 75 (1): 128–137. doi:10.1086/422196. PMID 12825075. S2CID 2834639.
  • The Genographic Project, National Geographic, Atlas of the Human Journey
  • ISOGG, Y-DNA Haplogroup I and its Subclades

References

  1. Grugni (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLOS ONE. 7 (7): e41252. Bibcode:2012PLoSO...741252G. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.
  2. "Publications Detail View". fgga.univie.ac.at. Retrieved 2020-12-15.
  3. Mounier, Aurélien; Heuzé, Yann; Samsel, Mathilde; Vasilyev, Sergey; Klaric, Laurent; Villotte, Sébastien (2020-12-14). "Gravettian cranial morphology and human group affinities during the European Upper Palaeolithic". Scientific Reports. 10 (1): 21931. Bibcode:2020NatSR..1021931M. doi:10.1038/s41598-020-78841-x. ISSN 2045-2322. PMC 7736346. PMID 33318530.
  4. Bennett, E. Andrew; Prat, Sandrine; Péan, Stéphane; Crépin, Laurent; Yanevich, Alexandr; Puaud, Simon; Grange, Thierry; Geigl, Eva-Maria (2019-07-02). "The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European". bioRxiv: 685404. doi:10.1101/685404. S2CID 198249005.
  5. Fu, Qiaomei; et al. (2016). "The genetic history of Ice Age Europe". Nature. 534 (7606): 200–5. Bibcode:2016Natur.534..200F. doi:10.1038/nature17993. PMC 4943878. PMID 27135931.
  6. Seguin-Orlando et al. (2014)「Genomic structure in Europeans dating back at least 36,200 years」
  7. Teschler-Nicola, Maria; Fernandes, Daniel; Händel, Marc; Einwögerer, Thomas; Simon, Ulrich; Neugebauer-Maresch, Christine; Tangl, Stefan; Heimel, Patrick; Dobsak, Toni; Retzmann, Anika; Prohaska, Thomas (2020-11-06). "Ancient DNA reveals monozygotic newborn twins from the Upper Palaeolithic". Communications Biology. 3 (1): 650. doi:10.1038/s42003-020-01372-8. ISSN 2399-3642. PMC 7648643. PMID 33159107.
  8. "Y-SNP calls for Krems WA3". Genetiker. 2016-05-11. Retrieved 2020-12-15.
  9. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  10. Clark PU, Dyke AS, Shakun JD, et al. (August 2009). "The Last Glacial Maximum". Science. 325 (5941): 710–4. Bibcode:2009Sci...325..710C. doi:10.1126/science.1172873. PMID 19661421. S2CID 1324559.
  11. Rootsi Siiri; Kivisild, Toomas; Benuzzi, Giorgia; Help, Hela; Bermisheva, Marina; Kutuev, Ildus; Barać, Lovorka; Peričić, Marijana; Balanovsky, Oleg; Pshenichnov, Andrey; Dion, Daniel; Grobei, Monica; Zhivotovsky, Lev A.; Battaglia, Vincenza; Achilli, Alessandro; Al-Zahery, Nadia; Parik, Jüri; King, Roy; Cinnioğlu, Cengiz; Khusnutdinova, Elsa; Rudan, Pavao; Balanovska, Elena; Scheffrahn, Wolfgang; Simonescu, Maya; Brehm, Antonio; Goncalves, Rita; Rosa, Alexandra; Moisan, Jean-Paul; Chaventre, Andre; Ferak, Vladimir; et al. (2004). "Phylogeography of Y-Chromosome Haplogroup I-M170 Reveals Distinct Domains of Prehistoric Gene Flow in Europe". American Journal of Human Genetics. 75 (1): 128–137. doi:10.1086/422196. PMC 1181996. PMID 15162323.
  12. P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
  13. Semino O, Passarino G, Oefner PJ, et al. (November 2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective". Science. 290 (5494): 1155–9. Bibcode:2000Sci...290.1155S. doi:10.1126/science.290.5494.1155. PMID 11073453.
  14. "Palaeolithic DNA from Eurasia". Archived from the original on 2016-10-03. Retrieved 5 October 2016.
  15. Fu, Qiaomei; Posth, Cosimo; Hajdinjak, Mateja; Petr, Martin; Mallick, Swapan; Fernandes, Daniel; Furtwängler, Anja; Haak, Wolfgang; Meyer, Matthias (2016). "The genetic history of Ice Age Europe". Nature. 534 (7606): 200–205. Bibcode:2016Natur.534..200F. doi:10.1038/nature17993. hdl:10211.3/198594. ISSN 0028-0836. PMC 4943878. PMID 27135931.
  16. "Ancient DNA reveals 'genetic continuity' between Stone Age and modern populations in East Asia". February 2017.
  17. Keyser-Tracqui, C; Crubézy, E; Ludes, B (August 2003). "Nuclear and Mitochondrial DNA Analysis of a 2,000-Year-Old Necropolis in the Egyin Gol Valley of Mongolia". Am. J. Hum. Genet. 73 (2): 247–60. doi:10.1086/377005. PMC 1180365. PMID 12858290.
  18. ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ
  19. Nasidze Ivan; Ling, E. Y. S.; Quinque, D.; Dupanloup, I.; Cordaux, R.; Rychkov, S.; Naumova, O.; Zhukova, O.; Sarraf-Zadegan, N.; Naderi, G. A.; Asgary, S.; Sardas, S.; Farhud, D. D.; Sarkisian, T.; Asadov, C.; Kerimov, A.; Stoneking, M. (2004). "Mitochondrial DNA and Y-Chromosome Variation in the Caucasus" (PDF). Annals of Human Genetics. 68 (Pt 3): 205–221. doi:10.1046/j.1529-8817.2004.00092.x. PMID 15180701. S2CID 27204150. Archived from the original (PDF) on 2017-01-18. Retrieved 2016-10-09.
  20. Yunusbayev 2011
  21. Haber, Marc; Platt, Daniel E.; Bonab, Maziar Ashrafian; Youhanna, Sonia C.; Soria-Hernanz, David F.; Martínez-Cruz, Begoña; Douaihy, Bouchra; Ghassibe-Sabbagh, Michella; Rafatpanah, Hoshang (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLOS ONE. 7 (3): e34288. Bibcode:2012PLoSO...734288H. doi:10.1371/journal.pone.0034288. ISSN 1932-6203. PMC 3314501. PMID 22470552.
  22. Haber, M; Platt, DE; Ashrafian Bonab, M; Youhanna, SC; Soria-Hernanz, DF; et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLOS ONE. 7 (3): e34288. Bibcode:2012PLoSO...734288H. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552.
  23. Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge
  24. Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  25. "Armenian DNA Project". Archived from the original on 2016-10-11. Retrieved 2016-10-08.
  26. "Where did European men come from?" (PDF). www.jogg.info. 2008. Retrieved 2019-06-07.
  27. "Comments on 2014 Klyosov Article on Jewish DNA Genealogy p. 1 of 2 - Levite DNA". Archived from the original on 2016-11-12. Retrieved 2016-10-09.
  28. Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа
  29. ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ
  30. Pericic M, Lauc LB, Klaric IM, et al. (October 2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations". Mol. Biol. Evol. 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443.
  31. Battaglia, Vincenza; Fornarino, Simona; Al-Zahery, Nadia; Olivieri, Anna; Pala, Maria; Myres, Natalie M; King, Roy J; Rootsi, Siiri; et al. (24 December 2008). "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe" (PDF). European Journal of Human Genetics. 17 (6): 820–30. doi:10.1038/ejhg.2008.249. PMC 2947100. PMID 19107149.
  32. Karachanak, Sena; Fornarino, Simona; Grugni, Viola; Semino, Ornella; Toncheva, Draga; Galabov, Angel; Atanasov, Boris (2009). "Y-Chromosomal Haplogroups in Bulgarians". Comptes rendus de l'Académie bulgare des Sciences. 62 (3): 393–400. ISSN 1310-1331. INIST:21359873.
  33. Karachanak S, Grugni V, Fornarino S, Nesheva D, Al-Zahery N, Battaglia V, Carossa V, Yordanov Y, Torroni A, Galabov AS, Toncheva D, Semino O (2013). Pereira LM (ed.). "Y-chromosome diversity in modern Bulgarians: new clues about their ancestry". PLOS ONE. 8 (3): e56779. Bibcode:2013PLoSO...856779K. doi:10.1371/journal.pone.0056779. PMC 3590186. PMID 23483890.
  34. "Bulgarian_Y_Table.xlsx".
  35. Barac L, Pericic M, Klaric IM, et al. (July 2003). "Y chromosomal heritage of Croatian population and its island isolates" (PDF). Eur. J. Hum. Genet. 11 (7): 535–42. doi:10.1038/sj.ejhg.5200992. PMID 12825075. S2CID 15822710.
  36. Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  37. Y-chromosomal variation in the Czech Republic
  38. Altena, E., Smeding, R., van der Gaag, K.J. et al. The Dutch Y-chromosomal landscape. Eur J Hum Genet 28, 287–299 (2020). https://doi.org/10.1038/s41431-019-0496-0
  39. ZONEN VAN ADAM IN NEDERLAND Genetische genealogie : een zoektocht in ons DNA-archief
  40. El-Sibai, Mirvat; Platt, Daniel E.; Haber, Marc; Xue, Yali; Youhanna, Sonia C.; Wells, R. Spencer; Izaabel, Hassan; Sanyoura, May F.; Harmanani, Haidar (2009). "Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast". Annals of Human Genetics. 73 (6): 568–581. doi:10.1111/j.1469-1809.2009.00538.x. ISSN 1469-1809. PMC 3312577. PMID 19686289.
  41. "Photo" (PNG). s-media-cache-ak0.pinimg.com. Retrieved 2019-06-07.
  42. Migration Eaves to the Baltic Region
  43. "Y Haplogroup Frequencies in the Flemish Populstion".
  44. Lappalainen, Tuuli; Koivumäki, Satu; Salmela, Elina; Huoponen, Kirsi; Sistonen, Pertti; Savontaus, Marja-Liisa; Lahermo, Päivi (19 July 2006). "Regional differences among the Finns: A Y-chromosomal perspective". Gene. 376 (2): 207–215. doi:10.1016/j.gene.2006.03.004. PMID 16644145.
  45. Ramos-Luis, E.; Blanco-Verea, A.; Brión, M.; Van Huffel, V.; Carracedo, A.; Sánchez-Diz, P. (December 2009). "Phylogeography of French male lineages". Forensic Science International: Genetics Supplement Series. 2 (1): 439–441. doi:10.1016/j.fsigss.2009.09.026. S2CID 85134429.
  46. Kayser, Manfred; Lao, Oscar; Anslinger, K; Augustin, Christa; Bargel, G.; Edelmann, J; Elias, Sahar; Heinrich, M; Henke, Jürgen (2005). "Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis". Human Genetics. 117 (5): 428–443. doi:10.1007/s00439-005-1333-9. ISSN 0340-6717. PMID 15959808. S2CID 11066186.
  47. "Archived copy" (PDF). Archived from the original (PDF) on 2017-01-20. Retrieved 2016-10-08.{{cite web}}: CS1 maint: archived copy as title (link)(subscription required)
  48. Sanchez, J.J.; Børsting, C.; Hernandez, A.; Mengel-Jørgensen, J.; Morling, N. (April 2004). "Y chromosome SNP haplogroups in Danes,Greenlanders and Somalis". International Congress Series. 1261: 347–349. doi:10.1016/S0531-5131(03)01635-2.
  49. Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)
  50. Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
  51. Tambets, K; Rootsi, S; Kivisild, T; et al. (April 2004). "The western and eastern roots of the Saami--the story of genetic "outliers" told by mitochondrial DNA and Y chromosomes". Am. J. Hum. Genet. 74 (4): 661–82. doi:10.1086/383203. PMC 1181943. PMID 15024688.
  52. A Y Chromosome Census of the British Isles
  53. Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
  54. Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects
  55. Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight
  56. Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage
  57. Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms
  58. Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome
  59. Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan
  60. Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ
  61. Y chromosomes in Iranians and Tajiks
  62. MtDNA and Y-chromosome Variation in Kurdish Groups
  63. The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants
  64. Pliss et al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region
  65. Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events
  66. Paternal lineages in Libya inferred from Y-chromosome haplogroups
  67. "Norway y DNA ftdna".
  68. Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)
  69. Micro-Phylogeographic and Demographic History of Portuguese Male Lineages
  70. Martinez-Cruz B, Ioana M, Calafell F, Arauna LR, Sanz P, Ionescu R, Boengiu S, Kalaydjieva L, Pamjav H, Makukh H, Plantinga T, van der Meer JW, Comas D, Netea MG (2012). Kivisild T (ed.). "Y-chromosome analysis in individuals bearing the Basarab name of the first dynasty of Wallachian kings". PLOS ONE. 7 (7): e41803. Bibcode:2012PLoSO...741803M. doi:10.1371/journal.pone.0041803. PMC 3404992. PMID 22848614.
  71. Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.
  72. The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms
  73. ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV
  74. Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
  75. Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History
  76. Karlsson, Andreas O; Wallerstrom, Thomas; Gotherstrom, Anders; Holmlund, Gunilla (2006). "Y-chromosome diversity in Sweden – A long-time perspective". European Journal of Human Genetics. 14 (8): 963–970. doi:10.1038/sj.ejhg.5201651. PMID 16724001.
  77. Rootsi S, Magri C, Kivisild T, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I-M170 reveals distinct domains of prehistoric gene flow in europe". Am. J. Hum. Genet. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323.
  78. "Swedish Haplogroup Database (Stats haplopie)". Archived from the original on 2016-10-10. Retrieved 2016-10-08.
  79. Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)
  80. Bosch, E.; Calafell, F.; Gonzalez-Neira, A.; Flaiz, C; Mateu, E; Scheil, HG; Huckenbeck, W; Efremovska, L; et al. (2006). "Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns". Annals of Human Genetics. 70 (Pt 4): 459–87. doi:10.1111/j.1469-1809.2005.00251.x. PMID 16759179. S2CID 23156886.
  81. Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (May 2008). "Migration waves to the Baltic Sea region". Ann. Hum. Genet. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
  82. ISOGG 2011
  83. Cinnioğlu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoğlu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; Lin, Alice A. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. ISSN 0340-6717. PMID 14586639. S2CID 10763736.
  84. "ISOGG 2017 Y-DNA Haplogroup I". isogg.org.
  85. Caciagli, Laura; Bulayeva, Kazima; Bulayev, Oleg; Bertoncini, Stefania; Taglioli, Luca; Pagani, Luca; Paoli, Giorgio; Tofanelli, Sergio (2009). "The key role of patrilineal inheritance in shaping the genetic variation of Dagestan highlanders". Journal of Human Genetics. 54 (12): 689–694. doi:10.1038/jhg.2009.94. ISSN 1434-5161. PMID 19911015.
  86. Rootsi, Siiri; Magri, Chiara; Kivisild, Toomas; Benuzzi, Giorgia; Help, Hela; Bermisheva, Marina; Kutuev, Ildus; Barać, Lovorka; Peričić, Marijana (2004). "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe". American Journal of Human Genetics. 75 (1): 128–137. doi:10.1086/422196. ISSN 0002-9297. PMC 1181996. PMID 15162323.
  87. Cristofaro J, et al. (October 2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  88. Allentoft, Morten E.; Sikora, Martin; Sjögren, Karl-Göran; Rasmussen, Simon; Rasmussen, Morten; Stenderup, Jesper; Damgaard, Peter B.; Schroeder, Hannes; Ahlström, Torbjörn; Vinner, Lasse; Malaspinas, Anna-Sapfo (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–172. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. ISSN 1476-4687. PMID 26062507. S2CID 4399103.
  89. Malmström, Helena; Gilbert, M. Thomas P.; Thomas, Mark G.; Brandström, Mikael; Storå, Jan; Molnar, Petra; Andersen, Pernille K.; Bendixen, Christian; Holmlund, Gunilla; Götherström, Anders; Willerslev, Eske (2009-11-03). "Ancient DNA Reveals Lack of Continuity between Neolithic Hunter-Gatherers and Contemporary Scandinavians". Current Biology. 19 (20): 1758–1762. doi:10.1016/j.cub.2009.09.017. ISSN 0960-9822. PMID 19781941.
  90. Karlsson, Andreas O.; Wallerström, Thomas; Götherström, Anders; Holmlund, Gunilla (August 2006). "Y-chromosome diversity in Sweden – A long-time perspective". European Journal of Human Genetics. 14 (8): 963–970. doi:10.1038/sj.ejhg.5201651. ISSN 1476-5438. PMID 16724001.
  91. Rootsi; et al. "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1" (PDF). Archived from the original (PDF) on 2007-03-03.
  92. Marjanovic D, Fornarino S, Montagna S, et al. (November 2005). "The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups". Ann. Hum. Genet. 69 (Pt 6): 757–63. doi:10.1111/j.1529-8817.2005.00190.x. PMID 16266413. S2CID 36632274.
  93. O.M. Utevska (2017). Генофонд українців за різними системами генетичних маркерів: походження і місце на європейському генетичному просторі [The gene pool of Ukrainians revealed by different systems of genetic markers: the origin and statement in Europe] (PhD) (in Ukrainian). National Research Center for Radiation Medicine of National Academy of Sciences of Ukraine. pp. 219–226, 302.
  94. McEvoy and Bradley, Brian P and Daniel G (2010). Celtic from the West Chapter 5: Irish Genetics and Celts. Oxbow Books, Oxford, UK. p. 117. ISBN 978-1-84217-410-4.
  95. Haber, Marc; Platt, Daniel E.; Ashrafian Bonab, Maziar; Youhanna, Sonia C.; Soria-Hernanz, David F.; Martínez-Cruz, Begoña; Douaihy, Bouchra; Ghassibe-Sabbagh, Michella; Rafatpanah, Hoshang; Ghanbari, Mohsen; Whale, John; Balanovsky, Oleg; Wells, R. Spencer; Comas, David; Tyler-Smith, Chris; Zalloua, Pierre A. (2012). "Afghanistan's ethnic groups share a Y-chromosomal heritage structured by historical events". PLOS ONE. 7 (3): e34288. Bibcode:2012PLoSO...734288H. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552.
  96. Grasgruber, Pavel; Popović, Stevo; Bokuvka, Dominik; Davidović, Ivan; Hřebíčková, Sylva; Ingrová, Pavlína; Potpara, Predrag; Prce, Stipan; Stračárová, Nikola (2017). "The mountains of giants: An anthropometric survey of male youths in Bosnia and Herzegovina". Royal Society Open Science. 4 (4): 161054. Bibcode:2017RSOS....461054G. doi:10.1098/rsos.161054. PMC 5414258. PMID 28484621.
  97. Grasgruber, P.; Cacek, J.; Kalina, T.; Sebera, M. (2014-12-01). "The role of nutrition and genetics as key determinants of the positive height trend". Economics & Human Biology. 15: 81–100. doi:10.1016/j.ehb.2014.07.002. ISSN 1570-677X. PMID 25190282.

Phylogenetic tree and distribution maps

Projects

Other

This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.